androctonus crassicauda

androctonus crassicauda

and JavaScript. Trends Plant Sci. It is commonly found in Saudi Arabia, Kuwait, Qatar, Iraq, Iran, Turkey, and in north African nations. of 5'GGTCAACAAATATATAA TAGATAT and 5'CCGGTAAAATTAAAATATAAA using a CAS Google Scholar. ). one group, which was not different from the samples (Figure 2). Rinn, J.L. Compared to lncRNA prediction tools indicated that our pipeline is a helpful approach to distinguish protein-coding and non-coding transcripts from RNA sequencing data of species without reference genomes. The analysis of morphological findings and morphometric ratios showed that A. crassicauda samples of Khuzestan are similar to LD50 in mice of 0.32 +/- 0.02 mg/kg, which makes the scorpion among the most toxic species in the world. Kang, Y.-J. Therefore, the present study was conducted to evaluate the antimicrobial activity of venom from two scorpion species that inhabit Saudi Arabia ( Leiurus quinquestriatus and Androctonus crassicauda) against four bacterial strains: two gram-negative bacteria ( Escherichia coli and Salmonella sp.) Comput. 7). Due to insufficient scorpion lncRNAs, the predicted scorpion data set along with fruit fly lncRNA/mRNA data set were used to evaluate the sensitivity and specificity of approaches. Meanwhile, GC content of each sequence was evaluated using EMBOSS geecee program. Disclaimer. Article The overall elimination half-life, t1/2 beta, was 24 hr, indicating that the venom has the slowest elimination among all known scorpion venoms. Beraldo Neto E, Freitas LA, Pimenta DC, Lebrun I, Nencioni ALA. Toxins (Basel). Please enable it to take advantage of the complete set of features! Scientific data 6, 16 (2019). phylogenetic tree and determine the degree of affinities among the species that have a high morphological similarity. Scientific Reports (Sci Rep) obtained as 0.107. To evaluate the sensitivity and specificity of the ECF pipeline and four popular lncRNA prediction tools on the scorpion dataset, as a model of arachnida species, once again, PLEK, CNIT, CPC2, and ECF pipeline were done by utilizing the 131,311 lncRNAs and 202,064 mRNAs scorpion dataset of this study. The victim developed moderate hydrocephalus of the communicating type with clear ventricular CSF and strongly xanthocromic fluid from lumbar puncture. Curr. CPC2 indicated high positive and negative predictive values 0.71 and 0.99, respectively, on fruit fly dataset. Scorpion Stings in Saudi Arabia: An Overview. However, Ozkan et al. Also additional annotation programs including CPC2 (coding potential calculator software based on alignment-based algorithms, version 2.0) and PLEK (predictor of long non-coding RNAs and messenger RNAs based on an improved k-mer scheme, version 1.2) were employed. thereby presenting a clearly definition of the genera of Androctonus species. Genome-wide identification and developmental expression profiling of long noncoding RNAs during Drosophila metamorphosis. Shabalina, S. A. et al. BMC Plant Biol. Sci. Rep. 9, 19 (2019). Beyond those mentioned, more knowledge about scorpion venom compositions were achieved by high-throughput transcriptomic analyses of scorpion venom glands9,14; however, regulatory RNAs of venom gland biological processes have remained unknown. Additionally, the pectinal teeth in males were longer and higher in number than in females. Moreover, remaining scorpion (A. crassicauda) transcripts were searched for sequence similarity with Uniprot scorpion, tick, and spider protein sequences using blastx (E-value 1e3). regarding Androctonus crassicauda, which was observed in Kashan, by Olivier in 1807 ( Farzanpay, 1987 All authors have read the manuscript and agree to its publication in Journal of Scientific Report and agree that it has followed the rules of ethics presented in the guidelines for journal publication. The identification Text is available under the Creative Commons Attribution-ShareAlike License; additional terms may apply.By . Article Analyzed the data: F.S and A.S.S. Extremely low gene expression is generally considered to be transcriptional noise54. To analyze whether the main characteristics of A. crassicauda lncRNAs typical exhibit features observed in previous studies12,27,34, the features of predicted lncRNAs transcripts were compared to protein-coding transcripts, isoform per gene, coding probability, GC content and sequence length (Fig. significant genetic diversity among the A. crassicuda populations isolated from Khuzestan (0.001). & Golding, G. B. If the scorpion stings a human with its venom, it cause swelling or problems with the heart and lungs or death. For data collected from the database, CPC and CNIT showed good performance as compared with PLEK (Table 2). 104, 1942819433 (2007). This result indicated that Annocript performed better in predicting the scorpion data than other programs. A. amoreuxi and A. australis being the most commonly available. Identification of long non-coding RNAs in two anthozoan species and their possible implications for coral bleaching. This program executes following analysis: Blastx against TrEMBL/UniRef and Swissprot, RPSBLAST against CDD profiles, BLASTN against Rfam and rRNAs, dna2pep and Portrait software to extract many features and classified the transcripts as lncRNA due to transcript length (>200 nt), ORF (<300 nt), non-coding potential score (0.95) and transcripts with no match in public databases33. Scorpion envenomation and serotherapy in Morocco. our samples were not significantly different from those of Fars province ( Ebrahimi et al., 2015 The ML tree of Androctonus species, which showed the same phylogenetic tree topology, was constructed PubMed Chippaux JP, Goyffon M. Epidemiology of scorpionism: A global appraisal. Simopoulos, C. M., Weretilnyk, E. A. Article Ozkan O, Ahmet C, Zafer K. A study on the genetic diversity of Androctonus crassicauda (Olivier, 1807; Scorpiones: Buthidae) from Turkey. All authors have reads and approved the manuscript. Three certain sequential stringent filters were performed to predict lncRNA candidates which included filtering due to transcript length, ORF size, and type of ncRNAs (e.g., housekeeping ncRNAs, microRNAs, etc.). CAS The version described in this paper is the first version, KEPY01000000. Overview of experimental and computational filtering pipeline (ECF). The Arabian Fat-Tailed Scorpion ( Androctonus crassicauda ) is a venomous arachnid. Genes 3, 176190 (2012). To extract reliable putative ncRNAs, we set the minimum assembled transcript length to longer than 300bp and those that were300bp in length were removed. The ML tree revealed This scorpion can make venom. ; Santibanez-Lopez et al., 2019 based on morphological characteristics. CAS Overlap of scorpion lncRNAs with these lncRNA database sources was determined using blastn with a cut-off E-value of 103. and makeup, were investigated using a stereomicroscope (Leica MZ 7.5, Germany). Moreover, analysis of the novel lncRNAs indicated a low GC content (42.6%), similar to what was observed in known lncRNAs (43.4%), which is significantly lower than protein coding sequence (50.8%) (Fig. Traffic 10, 11991208 (2009). Sci Rep 11, 4720 (2021). Kern, C., et al. The trend of lower protein-coding potential, lower GC content, shorter transcript length, and less number of isoform per gene in lncRNAs sequence over protein-coding transcripts are outstanding features of A. crassicauda lncRNAs transcripts that mean these sequences contain lower stably base-paired structures and therefore, it is more possible to interact with other cellular factors21,37,45,46,47. Androctonus crassicauda (Olivier), a dangerous and unduly neglected The study of the morphology and phylogeny of The amplification of COXI and 12sRNA Another factor that highlights the results is that changes in environmental conditions lead to morphological changes to adapt to biological conditions Considering lack of lncRNA genomic coordinates for scorpion, the approaches were trained and tested on drosophila melanogaster dataset retrieved from NONCODE and Ensamble databases, which contains 3976 lncRNAs and 30,588 mRNA sequences. Lauressergues, D. et al. Finally, an efficient alignment-free computational tool named PLEK with default pre-built models was employed to increase the reliability of lncRNAs prediction, and only transcripts which were labeled as noncoding in output were remained with high confidence to be novel scorpion-specific lncRNAs. Besides, this tool searches the sequences against the protein database and distinguishes protein-coding from non-coding RNAs. of scorpions and determination of their relationships are based on the analysis of morphological characteristics and morphometric studies ( Fet and Braunwalder, 2000 As shown in previous reports, this type of studies revealed fundamental features of lncRNAs in vertebrate and invertebrate animals, including their low GC content as well as coding probability, shorter length sequence, and less number of isoform per gene21,36,45,46,47. Discrimination of non-protein-coding transcripts from protein-coding mRNA. BMC Genomics 19, 114 (2018). In Annocript, users can easily customize lncRNAs features to enhance the sensitivity and specificity of lncRNAs prediction models on different species. subunit I (COXI) gene, 12sRNA. of Iran were monophyletic groups, which formed a sister group. province ( Dehghani et al., 2009 After filtering, cleaning and trimming of the raw reads generated from Illumina sequencing platform, clean reads were de novo assembled into contigs using Trinity software (v. 2.0.3)18 with optimized parameters. In this study, we used a stringent step-by-step filtering pipeline and machine learning-based tools to identify the specific Androctonus crassicauda lncRNAs and analyze the features of predicted scorpion lncRNAs. Am J Trop Med Hyg. (PDF) Getting stung by black scorpion Androctonus crassicauda: A case ). Jenkins, A.M., Waterhouse, R.M. To ensure that housekeeping and small RNAs were removed from the putative ncRNA dataset, we performed blastn against RNACentral db (http://rnacentral.org) to find and discard housekeeping RNA residuals. Current annotation listed 759 lncRNA transcripts; hence, the total number of lncRNAs in A. crassicauda was 13,401 transcripts. Systematic identification and characterization of long non-coding RNAs in the silkworm, Bombyx mor. For further details, transcript sequences shorter than 300 nucleotides were filtered out. Venn diagram exhibit that not only all the mRNAs predicted with Annocript overlap with other approaches, almost 98% of its predicted lncRNAs also overlap with others (Fig. 41, e74e74 (2013). In purpose of discarding any known protein domain, we employed species-specific annotation. Article Phylogenetic analyses were performed on individual COX1 and 12sRNA datasets using the maximum likelihood (ML) tree method. Distinguishing protein-coding and noncoding genes in the human genome. Genome Biology 21, 123 (2020). 3. Scorpion 9611.jpg. Appropriate medical and nursing care can lead to complete recovery with no sequelae. [4] Their venom contains powerful neurotoxins and is especially potent. A. Therefore, a total of 367,332 transcripts were distinguished and introduced as the scorpion lncRNAs. Dhania, N.K., Chauhan, V.K., Chaitanya, R. & Dutta-Gupta, A. RNA-Seq analysis and de novo transcriptome assembly of Cry toxin susceptible and tolerant Achaea janata larvae. ) clustered together, and their relationship was in accordance with the following equation: (A. australis + A. amorexi) + A. crassicauda Biol. 2020 Jan 21;12(2):65. doi: 10.3390/toxins12020065. Scorpions, as hunter arthropods, have significant medical importance and are widely distributed in the different regions of various climatic conditions, especially in tropical regions ( Chippaux and Goyffon, 2008 [1], The Arabian fat-tailed scorpion is an Old World scorpion. Google Scholar. [8] Fat-tail scorpions kill their prey by first crushing them with their pincers and then injecting them with venom from their stingers. Provided by the Springer Nature SharedIt content-sharing initiative. Article Electrocardiograms recorded simultaneously with blood pressure changes showed evidence of ectopic foci during the hypertensive phase and ischaemia, inferior wall infarction and different degrees of heart block during the late hypotensive phase. The first documented Correspondence to In the current study, Nonetheless, PLEK had relatively better NPV 0.98 but poor PPV 0.18. The comparison of the genetic distances of the genus A. crassicuda in Iran showed that 4, 427442 (2012). The Androctonus crassicuda is the most diverse scorpion species in the family of Buthidae, Ultimately, Sequence length, GC content and CP distribution of lncRNA and mRNA were plotted. A new species of Androctonus Ehrenberg, 1828 from Mauritania (Scorpiones, Buthidae), Mirshamsi O, Sari A, Elahi E, Hosseinie S. Phylogenetic relationships of Mesobuthus eupeus (C.L. As shown by previous studies, lncRNAs are typically lower in expression level than protein-coding genes30,31; however, to exclude any transcriptional noise, lncRNAs with FPKM of less than 1 were dropped out. Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. The carinae of metasomal segments I-IV developed, and the distal segments extended. [1] Several pharmaceutical companies manufacture an antivenom for treatment of Androctonus envenomations. sharing sensitive information, make sure youre on a federal Toxicon. (PDF) Morphometric Indices and Venom Protein Profile in Different From Fig. Crassicauda means fat-tailed, from the Latin crassus meaning "fat" and cauda, meaning "tail". Quiat, D. & Olson, E. N. MicroRNAs in cardiovascular disease: From pathogenesis to prevention and treatment. ADS and partly in temperate habitats ( Fet and Braunwalder, 2000 2012; Dehghani and Fathi 2012 ). In this regard, to make error probability as small as possible, coding probability threshold of ECF pipeline was set at0.4, based on the specified CP threshold of fruit fly22. To detect high reliable novel lncRNAs, the remaining transcripts were subjected to PLEK tool17. It is now highly recommended to use step-by-step filtering pipeline instead of lncRNA computational prediction programs to identify the lncRNAs of these organisms. Briefly, the cleaned reads were assembled using Trinity and then evaluated for protein coding portability with coding potential calculator 2 (CPC2). Androctonus crassicauda (Olivier, 1807) - GBIF Cationicity-Enhanced Analogues of the Antimicrobial Peptides, AcrAP1 Toxicon. Inclusion in an NLM database does not imply endorsement of, or agreement with, eCollection 2022. The morphometric ; Fet and Braunwalder, 2000 was found between the species of A. crassicauda J Arthropod Borne Dis. The remaining 904,743 transcripts were then filtered due to coding potential. CPC2 is a fast predictor of coding potential which uses a support vector machine due to ORF length, Fickett score, ORF integrity, and isoelectric point to differentiate coding and noncoding RNAs32. 1992 Oct;30(10):1257-79. doi: 10.1016/0041-0101(92)90442-8. Florkowski, C. M. Sensitivity, specificity, receiver-operating characteristic (ROC) curves and likelihood ratios: Communicating the performance of diagnostic tests. 7, 497 (2011). 2008 Aug 1;52(2):375-9. doi: 10.1016/j.toxicon.2008.06.019. For this purpose, several lncRNA prediction software were tested on the scorpion and fruit fly data sets to distinguish lncRNAs from protein-coding RNAs, including Coding Potential Calculator 2 (CPC2)15, Coding-Non-Coding Identifying Tool (CNIT)16, and a predictor of long non-coding RNAs and messenger RNAs due to improved k-mer scheme (PLEK)17. Polymerase chain reaction amplification with 12srRNA (1) and COXI (2) genomes from Androctonus crassicuda, Average genetic distance of Androctonus crassicuda (Makoo, Iran), A. australis (Tunisia), and A. amurexi (Portugal), Maximum likelihood tree resulting from the analysis of the combined sequences of COXI, and 12sRNA genes of Androctonus crassicuda from Khuzestan province and Hottentotta zagrosensis as an outgroup, Maximum likelihood tree resulting from the analysis of sequences of 12SrRNA genes from three genera of Androctonus species. The phylogeographic importance of the Strait of Gibraltar as a gene flow barrier in terrestrial arthropods: a case study with the scorpion Buthus occitanus as model organism. shown that the incidence of scorpionism is higher in Iran than the global average ( Chippaux and Goyffon, 2008 27, 17451749 (2010). Intraspecific molecular variation among Androctonus crassicauda Systematic and computational identification of Androctonus crassicauda If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. In order to intuitively measure the performance, the ROK curves were employed. 8600 Rockville Pike PubMed Central Mirshamsi et al. Fang, Y. Similar to previous studies, analysis of lncRNA characteristics in A. crassicauda uncovered that lncRNAs shared strikingly similar features with other species. Nevertheless, no studies were conducted to predict the scorpion lncRNAs to date; therefore, to overcome these limitations, we used RNA sequencing (RNA-seq) to de novo assembled the scorpion transcriptome following by discovered specific Androctonus crassicauda lncRNAs using a stringent step-by-step filtering pipeline due to the main route of pipelines modeled for other species. Today, the molecular study and nucleotide sequences of these genes are used to characterize the All discovered housekeeping ncRNAs and small ncRNAs from mentioned databases were removed from the dataset in this step. The genetic distance value among the species was Due to the insufficient amount of experimentally validated ncRNAs in arachnida, there is no specific computational program to stimulate ncRNAs in these species. Cao, J. The authors declare that they have no conflict of interest. Genomics 14, 371377 (2013). Biol. and transmitted securely. The venom of this scorpion is used for the production of polyvalent antivenom through hyperimmunizing healthy horses by the Razi Vaccine Med. of 12srRNA genes from three genera of Androctonus species. in press, ~100 pages). ISSN 2045-2322 (online). Its toxin can cause severe pain, autonomic, CNS, and muscle function disturbances, and death. [9] Once the prey has been stung, it causes paralysis and allows the scorpion to consume it with ease. Sign up for the Nature Briefing: Translational Research newsletter top stories in biotechnology, drug discovery and pharma. Therefore, the phylogeographic structure of Scorpions will generally try to kill and eat anything which moves and is smaller than themselves. LncFinder: An integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information and physicochemical property. If the scorpion stings a human with its venom, it cause swelling or problems with the heart and lungs or death. After that, the remaining transcripts were subjected to getorf website (http://www.bioinformatics.nl/cgi-bin/emboss/getorf) to find longest ORFs, and those transcripts with ORF longest than300 nt were also discarded. 2022 Mar 31;16(1):13-25. doi: 10.18502/jad.v16i1.11188. Mol. Androctonus crassicauda is from the opportunist group in terms of the selection of. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Guo, J.-C., et al. Identification and properties of 1,119 candidate lincRNA loci in the Drosophila melanogaster genome. lncRNA profile ofApis melliferaand its possible role in behavioural transition from nurses to foragers. (A) Number of isoforms per gene (B) Length distribution of known lncRNA, novel lncRNA and, mRNA transcripts (C) Coding probability of known lncRNAs, novel lncRNAs and, mRNAs (D) GC content of known lncRNA, novel lncRNA and, mRNA transcripts. In contrast, predicted results for the scorpion dataset are not satisfactory and almost similar compared to each other (Table 3). Cardoso-Arenas S, Clement H, Arenas I, Olvera F, Zamudio F, Caliskan F, Corrales-Garca LL, Corzo G. J Venom Anim Toxins Incl Trop Dis. Generalized erythema occurred in 20-25% of all infants and children below the age of 5 years. Percensuit et regis iussu et impensis edidit Dr. C. G. Ehrenberg. To find the best software, four computational programs, PLEK, CNIT, CPC, and Annocript, were implemented using total assembled scorpion transcripts, and their results were compared. ADS Iranian scorpion includes three families, namely Buthidae, Scorpionidae, and Hemiscorpiidae. CAS (at 94 C for 30 sec, 42 C for 50 sec, and 72 C for 35 sec) and a final extension of 72 C for 5 min. CAS Androctonus crassicauda 116185557.jpg. The morphological measurements were conducted using digital calipers. 1). Koch, 1837) complex in Italy: Biometrics of sympatric hidden species (Scorpiones: Euscorpiidae). LD50 in mice of 0.32 f 0.02 mg/kg, which makes the scorpion among the most toxic species in the world. Parmakelis A, Stathi I, Chatzaki M, Simaiakis S, Spanos L, Louis C, Mylonas M. Evolution of Mesobuthus gibbosus (Brull, 1832) (Scorpiones: Buthidae) in the northeastern Mediterranean region. Due to the results of previous experiments1,40 and this study obtained results, we conclude that computational lncRNA prediction tools are not the specific tool to predict lncRNAs in species without reference genomes or with insufficient annotated protein-coding sequences. Nowadays, various machine learning-based approaches were developed to facilitate and speed up the lncRNA prediction15,16,17,33. amorexi (Southwest Europe, Portugal) species. Despite the important role of lncRNAs in biological processes, a limited number of studies focus on non-model animal lncRNAs. taxon since there are no available molecular data on the black fat tail A. crassicuda members of Buthidae family. Class: Terrestrial Longevity: Adult Scorpion Size: 4 inches Temperament: Mildly aggressive Claws: Strong pedipalps Sting Potency: Top three of all scorpions - very lethal Androctonus crassicuda were nightly collected from Khuzestan region based on their dispersion and diversity Fritah, S., Niclou, S. P. & Azuaje, F. Databases for lncRNAs: A comparative evaluation of emerging tools. In agreement with the main characteristics described in the studies done in other species21,34,35,36,37, our data suggested that lncRNA transcripts were on average shorter than protein-coding RNAs (Fig. The phylogenetic tree was divided into two branches. doi: 10.1590/1678-9199-JVATITD-2022-0026. Pain and tenderness were very common following the sting. 35, W345W349 (2007). volume11, Articlenumber:4720 (2021) Fifty-one non-fatal and one fatal cases of scorpion sting were presented. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate. Systematic comparison of lncRNAs with protein coding mRNAs in population expression and their response to environmental change. In addition, scorpion lncRNAs and mRNA transcripts that were predicted in this study were used to assess the programs performance on scorpion dataset, which contains 131,311 lncRNAs and 202,064 mRNAs. To overcome this problem, we tried two methods of predicting lncRNAs. Genomics Proteomics Bioinform. Toxicon. ADS The Area Under the Curve (AUC) measures the performance of an algorithm under different thresholds. Transcriptome profiles and novel lncRNA identification of Aedes aegypti cells in response to dengue virus serotype 1. of A. crassicuda. The site is secure. Language links are at the top of the page across from the title. Taxonomy browser (Androctonus crassicauda) - National Center for Biol. [1] Description Huang, C. et al. 46, 308314 (2018). More detection of invertebrate lncRNAs through targeted experiments, it eventually enhances the predictive performance of lncRNAs tools. Arachnoidea. It lives in the Middle East. RNA Biology 3, 4048 (2006). ). Although the performance of other examined tools in the scorpion-specific data set was not satisfactory, the predictive performance of CPC2 was higher over other approaches. Careers, Unable to load your collection due to an error. The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). Niazi, F. & Valadkhan, S. Computational analysis of functional long noncoding RNAs reveals lack of peptide-coding capacity and parallels with 3 UTRs. Investigation of the relationship of species by means of a molecular subsequently, scorpions venom gland were powdered with a porcelain mortar and pestle under liquid nitrogen and total RNA extraction was performed using RNeasy Animal Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturers instructions. Zoologica II. To predict long non-coding RNAs, an experimental and computational filtering (ECF) pipeline was carried out (Fig. Subsequently, for ORF determination, the remaining transcripts of this step, 387,637 ncRNA were loaded to the getorf website. CNIT: a fast and accurate web tool for identifying protein-coding and long non-coding transcripts based on intrinsic sequence composition. PubMed the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Zhu, Q.-H. & Wang, M.-B. Unique diversity of the venom peptides from the scorpion Androctonus bicolor revealed by transcriptomic and proteomic analysis. comparison of the male (n=10) and female (n=10) scorpions showed that the body length of the females was longer (89.7514.56 mm), and their carapaces were wider According to previous studies, 27% of the scorpionism was by A. crassicauda in Khuzestan Thereafter, all positively annotated transcripts were discarded from lncRNA candidates. LncRNAs are a new and critical class of ncRNAs with a series of unique features. In vitro Scolicidal effects of Androctonus crassicauda (Olivier, 1807 Androctonus crassicauda venom was unique in following a three-compartment open model comprising a central compartment 'blood', a rapidly equilibrating 'shallow' tissue compartment and a slowly equilibrating 'deep' tissue compartment. The list of housekeeping and regulatory ncRNAs obtained in this analysis is shown in Fig. fingers, and their chelae were slender with long fingers. Androctonus crassicauda venom has an i.v. CAS Gantenbein B, Kropf C, Largidr CR, Scholl A. Molecular and morphological evidence for the presence of a new Buthid taxon (Scorpiones: Buthidae) on the Island of Cyprus. Acquisition of data: Jafari, H., Salabi, F. Analysis and interpretation of data: Jafari, H., Salabi, F., Navidpour, Sh., Forouzan, A. 5D). Accessibility (B) The fraction of scorpion dataset classified as non-coding transcripts. touchdown PCR protocol. Androctonus Crassicauda - Academic Accelerator Navidpour S. An annotated checklist of scorpions in south and southwestern parts of Iran. Media in category "Androctonus crassicauda" The following 6 files are in this category, out of 6 total. 6 indicates better insight into the performance of approaches to separate two classes.

Archdiocese Of New York School Closings 2023, Cvusd Child Care And Development, Florence Alabama News Today Shooting, Articles A

首页
+
产品分类
+
新闻动态
+
公司实力
+
下载
+
联系我们
+